circad | circRNAs associated with diseases

hsa_circ_0098964
Gene	SRGAP1	Organism	Human
Genome Locus	chr12:64474065-64521504:+	Build	hg19
Disease	Coronary Artery Disease (CAD)	ICD-10	Atherosclerotic cardiovascular disease, so described (I25)
DBLink	Link to database	PMID	28045102
Experimental Method
Sample Type	Blood samples	Comparison	2 Coronary Artery Disease (CAD) patients and 12 control individuals
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCCGACAGACCGTCATCCT Reverse TATGACCTTCTCCCAGGGTCC	Statistics	Fold Change : Upregulated,2.40156312 pvalue : p=0.0000346027
Citation
Zhao, Z, Li, X, Gao, C, Jian, D, Hao, P, Rao, L, Li, M (2017). Peripheral blood circular RNA hsa_circ_0124644 can be used as a diagnostic biomarker of coronary artery disease. Sci Rep, 7:39918.